Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATCATTCCTAATGTTGTAAAATACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTGGATATCTTGACCTACGTGGCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGAAGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGGGGAAAGGCTGGGAGTTCACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTATGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATAAAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LDHA(3939)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Weiyou Zhu et al.
American journal of translational research, 10(7), 2055-2067 (2018-08-11)
The use of human epidermal growth factor receptor-2 (HER2) as a biomarker for gastric cancer (GC) has greatly helped some patients receive benefit from HER2-targeted therapy. However, the correlation between HER2 and other biochemical markers is unclear. The aim of
Michael Koukourakis et al.
Biochemical and biophysical research communications, 491(4), 932-938 (2017-08-02)
Up-regulation of lactate dehydrogenase LDHA, is a frequent event in human malignancies and relate to poor postoperative outcome. In the current study we examined the hypothesis that LDHA and anaerobic glycolysis, may contribute to the resistance of glioblastoma to radiotherapy
Michael I Koukourakis et al.
Laboratory investigation; a journal of technical methods and pathology, 97(11), 1321-1331 (2017-08-29)
Cooperation of cancer cells with stromal cells, such as cancer-associated fibroblasts (CAFs), has been revealed as a mechanism sustaining cancer cell survival and growth. In the current study, we focus on the metabolic interactions of MRC5 lung fibroblasts with lung
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU108531-20UG | 04061831357950 |
| EHU108531-50UG | 04061828368518 |