Skip to Content
Merck
CN

EHU108931

MISSION® esiRNA

targeting human PA2G4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGGGGACCCAAGTAACAGGGAGGAAAGCAGATGTTATTAAGGCAGCTCACCTTTGTGCTGAAGCTGCCCTACGCCTGGTCAAACCTGGAAATCAGAACACACAAGTGACAGAAGCCTGGAACAAAGTTGCCCACTCATTTAACTGCACGCCAATAGAAGGTATGCTGTCACACCAGTTGAAGCAGCATGTCATCGATGGAGAAAAAACCATTATCCAGAATCCCACAGACCAGCAGAAGAAGGACCATGAAAAAGCTGAATTTGAGGTACATGAAGTATATGCTGTGGATGTTCTCGTCAGCTCAGGAGAGGGCAAGGCCAAGGATGCAGGACAGAGAACCACTATTTACAAACGAGACCCCTCTAAACAGTATGGACTGAAAATGAAAACTTCACGTGCCTTCTTCAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Zhou et al.
PloS one, 16(2), e0245832-e0245832 (2021-02-03)
HER2 amplification greatly contributes to the tumorigenesis of multiple cancers. Intronic miR-4728-5p is transcribed along with its host gene HER2. However, little is known about the role of miR-4728-5p in cancer. This study aims to elucidate the potential role of
Priyanka Somanath et al.
Stem cells (Dayton, Ohio), 36(5), 671-682 (2018-01-13)
Developmental Pluripotency-Associated-4 (DPPA4) is one of the few core pluripotency genes lacking clearly defined molecular and cellular functions. Here, we used a proteomics screening approach of human embryonic stem cell (hESC) nuclear extract to determine DPPA4 molecular functions through identification
Ju-Yun Wu et al.
Cancers, 11(5) (2019-05-16)
Novel drugs targeting Wnt signaling are gradually being developed for hepatocellular carcinoma (HCC) treatment. In this study, we used a Wnt-responsive Super-TOPflash (STF) luciferase reporter assay to screen a new compound targeting Wnt signaling. 3-(5'-Hydroxymethyl-2'-furyl)-1-benzylindazole (YC-1) was identified as a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service