Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAGGGGACCCAAGTAACAGGGAGGAAAGCAGATGTTATTAAGGCAGCTCACCTTTGTGCTGAAGCTGCCCTACGCCTGGTCAAACCTGGAAATCAGAACACACAAGTGACAGAAGCCTGGAACAAAGTTGCCCACTCATTTAACTGCACGCCAATAGAAGGTATGCTGTCACACCAGTTGAAGCAGCATGTCATCGATGGAGAAAAAACCATTATCCAGAATCCCACAGACCAGCAGAAGAAGGACCATGAAAAAGCTGAATTTGAGGTACATGAAGTATATGCTGTGGATGTTCTCGTCAGCTCAGGAGAGGGCAAGGCCAAGGATGCAGGACAGAGAACCACTATTTACAAACGAGACCCCTCTAAACAGTATGGACTGAAAATGAAAACTTCACGTGCCTTCTTCAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PA2G4(5036)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yu Zhou et al.
PloS one, 16(2), e0245832-e0245832 (2021-02-03)
HER2 amplification greatly contributes to the tumorigenesis of multiple cancers. Intronic miR-4728-5p is transcribed along with its host gene HER2. However, little is known about the role of miR-4728-5p in cancer. This study aims to elucidate the potential role of
Priyanka Somanath et al.
Stem cells (Dayton, Ohio), 36(5), 671-682 (2018-01-13)
Developmental Pluripotency-Associated-4 (DPPA4) is one of the few core pluripotency genes lacking clearly defined molecular and cellular functions. Here, we used a proteomics screening approach of human embryonic stem cell (hESC) nuclear extract to determine DPPA4 molecular functions through identification
Ju-Yun Wu et al.
Cancers, 11(5) (2019-05-16)
Novel drugs targeting Wnt signaling are gradually being developed for hepatocellular carcinoma (HCC) treatment. In this study, we used a Wnt-responsive Super-TOPflash (STF) luciferase reporter assay to screen a new compound targeting Wnt signaling. 3-(5'-Hydroxymethyl-2'-furyl)-1-benzylindazole (YC-1) was identified as a
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU108931-20UG | 04061831358001 |
| EHU108931-50UG | 04061828368884 |