Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCTGGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGAGCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GBA(2629)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Tiziana Squillaro et al.
Journal of cellular physiology, 232(12), 3454-3467 (2017-01-18)
Lysosomal storage disorders (LDS) comprise a group of rare multisystemic diseases resulting from inherited gene mutations that impair lysosomal homeostasis. The most common LSDs, Gaucher disease (GD), and Fabry disease (FD) are caused by deficiencies in the lysosomal glucocerebrosidase (GBA)
Kecheng Zhou et al.
The American journal of pathology, 190(10), 2018-2028 (2020-07-18)
Studies of lysosome associated protein transmembrane 4B (LAPTM4B) have mainly focused on the 35-kDa isoform and its association with poor prognosis in cancers. Here, by employing a novel monoclonal antibody, the authors found that the 24-kDa LAPTM4B isoform predominated in
Jong-Won Lim et al.
Human molecular genetics, 24(17), 4817-4828 (2015-06-05)
Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU109121-50UG | 04061828355358 |
| EHU109121-20UG | 04061828592203 |