Skip to Content
Merck
CN

EHU109561

MISSION® esiRNA

targeting human PSMD4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human PSMD4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGACTTCTTACCCACCAGGCTGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAGACCCGCAGCAACCCTGAGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTGCTGACCACACTCACCCCAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCCAAGGGCAAGATCACCTTCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGACAAGGCAAGAATCACAAGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAATGAGAAGGATCTGGTGAAACTGGCTAAACGCCTCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

wgk

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pere Dosta et al.
Cardiovascular engineering and technology, 12(1), 114-125 (2021-01-22)
Endothelial cell (EC) dysfunction underlies the pathology of multiple disease conditions including cardiovascular and pulmonary diseases. Dysfunctional ECs have a distinctive gene expression profile compared to healthy ECs. RNAi therapy is a powerful therapeutic approach that can be used to
Ai-Guo Ma et al.
The Kaohsiung journal of medical sciences, 35(10), 591-597 (2019-06-05)
Proteasome 26S subunit non-ATPase 4 (PSMD4) is an important proteasome ubiquitin receptor and plays a key role in endoplasmic reticulum stress (ERS). However, the study of PSMD4 in esophageal cancer (EC) is relatively rare. Here, we found that the expression
Padma Murthi et al.
Cells, 9(4) (2020-04-16)
We reported earlier that an anti-inflammatory small peptide receptor-formyl peptide receptor-2 (FPR2) was significantly decreased in placentas from third trimester pregnancies complicated with fetal growth restriction (FGR), compared to placentas from uncomplicated control pregnancies, suggesting FPR2 may play a role
Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A
Lei Xu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13194-13210 (2020-12-16)
Ablation of miR-144/451 disrupts homeostasis of erythropoiesis. Myc, a protooncogenic protein, is essential for erythroblast proliferation but commits rapid downregulation during erythroid maturation. How erythroblasts orchestrate maturation processes through coding and non-coding genes is largely unknown. In this study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service