Skip to Content
Merck
CN

EHU110781

MISSION® esiRNA

targeting human FEN1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FEN1

form

lyophilized powder

description

Powered by Eupheria Biotech

product line

MISSION®

esiRNA cDNA target sequence

GATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGCAGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAGCAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAGTGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAGGCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATGGACTGCCTCACCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Song-Bai Liu et al.
Combinatorial chemistry & high throughput screening, 22(6), 379-386 (2019-07-06)
Flap endonuclease-1 (FEN1) plays a central role in DNA replication and DNA damage repair process. In mammals, FEN1 functional sites variation is related to cancer and chronic inflammation, and supports the role of FEN1 as a tumor suppressor. However, FEN1
Xue Zeng et al.
Experimental and therapeutic medicine, 14(4), 3265-3272 (2017-09-16)
Trastuzumab has been widely applied as a treatment for human epidermal growth factor 2 (HER2)-overexpressing breast cancer. However, the therapeutic efficacy of trastuzumab is limited. Flap endonuclease 1 (FEN1) is a multifunctional endonuclease that has a crucial role in DNA
Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Y Wang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(8), 1026-1033 (2019-02-04)
Flap endonuclease 1 (FEN1) is up-regulated by estrogen (17β-estradiol, E2) and related to cisplatin resistance of human breast cancer cells. Letrozole, an aromatase inhibitor, suppresses the change of testosterone into estrogen and is frequently used to treat breast cancer. However
Xue Zeng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 10717-10730 (2019-07-04)
Flap endonuclease 1 (FEN1) is recognized as a pivotal factor in DNA replication, long-patch excision repair, and telomere maintenance. Excessive FEN1 expression has been reported to be closely associated with cancer progression, but the specific mechanism has not yet been

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service