Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TPT1(7178)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
siRNA targeting TCTP suppresses osteosarcoma cell growth and induces apoptosis in vitro and in vivo.
Jian-Hui Shen et al.
Biotechnology and applied biochemistry, 63(1), 5-14 (2014-12-20)
Osteosarcoma (OS) remains the most frequent primary malignant bone tumor in adolescents. However, the molecular cause of the disease is poorly elucidated. In the present study, we primarily found that translationally controlled tumor protein (TCTP) was overexpressed in human OS
Seong-Yeon Bae et al.
Scientific reports, 5, 8061-8061 (2015-01-28)
Translationally controlled tumor protein (TCTP), is a highly conserved protein involved in fundamental processes, such as cell proliferation and growth, tumorigenesis, apoptosis, pluripotency, and cell cycle regulation. TCTP also inhibits Na,K-ATPase whose subunits have been suggested as a marker of
Ruilin Sun et al.
OncoTargets and therapy, 12, 1641-1653 (2019-03-19)
Lung cancer is the most common and lethal malignancy worldwide. TCTP is highly expressed in various cancers including lung cancer. Epithelial-mesenchymal transition (EMT) could increase cancer cell invasion. Whether TCTP's expression is associated with EMT in lung adenocarcinoma is largely
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU111621-20UG | 04061831358421 |
| EHU111621-50UG | 04061831374803 |