Skip to Content
Merck
CN

EHU112591

MISSION® esiRNA

targeting human MT2A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MT2A(4502)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weiling Leng et al.
International journal of inflammation, 2015, 301562-301562 (2016-02-18)
Our research group firstly discovered endothelial-overexpressed lipopolysaccharide-associated factor 1 (EOLA1, GenBank number AY074889) as a lipopolysaccharide (LPS) responsive gene in ECV304 cells. The previous studies have further demonstrated the association of EOLA1 with metallothionein 2A (MT2A), while the role of
João Rafael Habib Souza Aquime et al.
Cells, 9(1) (2020-01-16)
Mucoepidermoid carcinoma (MEC) is the most common tumor in the salivary glands, often presenting with recurrence and metastasis due to its high invasive capacity. Metallothionein (MT), a zinc storage protein that supplies this element for protease activity, is probably related
Chao Zhang et al.
Journal of cardiovascular pharmacology, 76(2), 197-206 (2020-05-21)
Previous studies have shown that melatonin (Mel) can effectively ameliorate myocardial ischemia/reperfusion (MI/R) injury, but the mechanism is yet to be fully elucidated. Mel receptors are expressed in the paraventricular nucleus (PVN), which is also involved in regulating cardiac sympathetic
Youn Hee Park et al.
Journal of neuroinflammation, 10, 21-21 (2013-02-05)
Hypothermic protection against ischemic stroke has been reported by many studies. Hypothermia is supposed to mitigate the effects of deleterious genes and proteins and promote the activity of protective genes and proteins in the ischemic brain. Metallothionein (MT)-1/2 is thought
N Habel et al.
Cell death & disease, 4, e874-e874 (2013-10-26)
Osteosarcoma is the most common primary tumor of bone occurring in children and adolescents. The histological response to chemotherapy represents a key clinical factor related to survival. We previously showed that statins exhibit antitumor effects in vitro, inducing apoptotic cell

Global Trade Item Number

SKUGTIN
EHU112591-50UG04061828405848
EHU112591-20UG04061831363425

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service