Skip to Content
Merck
CN

EHU113061

MISSION® esiRNA

targeting human UBE3A

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGCTGCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTCACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Imran Jamal et al.
Neurobiology of disease, 105, 99-108 (2017-06-04)
Angelman syndrome (AS) is a neurodevelopmental disorder characterized by severe intellectual and developmental disabilities. The disease is caused by the loss of function of maternally inherited UBE3A, a gene that exhibits paternal-specific imprinting in neuronal tissues. Ube3a-maternal deficient mice (AS
Tsubasa Munakata et al.
PLoS pathogens, 3(9), 1335-1347 (2007-10-03)
Hepatitis C virus (HCV) is a positive-strand RNA virus that frequently causes persistent infections and is uniquely associated with the development of hepatocellular carcinoma. While the mechanism(s) by which the virus promotes cancer are poorly defined, previous studies indicate that
Yanfei Li et al.
Acta biochimica et biophysica Sinica, 52(1), 58-63 (2019-11-05)
Cardiac hypertrophy is considered to be a leading factor in heart function-related deaths. In this study, we explored the potential mechanism underlying cardiac hypertrophy induced by isoproterenol. Our results showed that isoproterenol induced cardiac hypertrophy in AC16 cells, as reflected
Fei Zhang et al.
Journal of orthopaedic surgery and research, 12(1), 103-103 (2017-07-07)
Osteosarcoma (OS) is one of the most common malignant tumors developed in the bone. EZH2 has been found to play pivotal roles in the development of various cancers. LncRNA-ANCR (anti-differentiation ncRNA) has been reported to interact with EZH2 and regulated
Dohun Pyeon et al.
Viruses, 11(12) (2019-12-01)
Molecular basis of HIV-1 life cycle regulation has thus far focused on viral gene stage-specificity, despite the quintessence of post-function protein elimination processes in the virus life cycle and consequent pathogenesis. Our studies demonstrated that a key pathogenic HIV-1 viral

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service