Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGCCTCAGGAGGAGTCTGAAGAAGAAGTAGAGGAACCTGAAGAAAGACAGCAAACACCTGAGGTGGTACCTGATGATTCTGGAACTTTCTATGATCAGGCAGTTGTCAGTAATGACATGGAAGAACATTTAGAGGAGCCTGTTGCTGAACCAGAGCCTGATCCTGAACCAGAACCAGAACAAGAACCTGTATCTGAAATCCAAGAGGAAAAGCCTGAGCCAGTATTAGAAGAAACTGCCCCTGAGGATGCTCAGAAGAGTTCTTCTCCAGCACCTGCAGACATAGCTCAGACAGTACAGGAAGACTTGAGGACATTTTCTTGGGCATCTGTGACCAGTAAGAATCTTCCACCCAGTGGAGCTGTTCCAGTTACTGGGATACCACCTCATGTTGTTAAAGTACCAGCTTCACAGCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... G3BP1(10146)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ning Dou et al.
American journal of cancer research, 6(11), 2641-2650 (2016-12-03)
RasGAP SH3-domain-Binding Protein 1 (G3BP1) has been implicated in cell growth, migration, and metastasis of some cancers, yet its function in hepatocellular carcinoma (HCC) remains to be explored. In the present study, we reported that G3BP1 was upregulated in HCC
Amr Omer et al.
EMBO reports, 19(5) (2018-03-30)
Cellular senescence is a physiological response by which an organism halts the proliferation of potentially harmful and damaged cells. However, the accumulation of senescent cells over time can become deleterious leading to diseases and physiological decline. Our data reveal a
Allison B Herman et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(10), 2014-2027 (2019-08-30)
Stress granules (SGs) are dynamic cytoplasmic aggregates containing mRNA, RNA-binding proteins, and translation factors that form in response to cellular stress. SGs have been shown to contribute to the pathogenesis of several human diseases, but their role in vascular diseases
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU113241-50UG | 04061828399932 |
| EHU113241-20UG | 04061831358599 |