Merck
CN
All Photos(1)

Documents

Safety Information

EHU113521

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPD1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGCAAGTGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Justin F Deniset et al.
Cellular signalling, 47, 44-51 (2018-03-30)
Heat shock protein 60 (Hsp60) is a mediator of stress-induced vascular smooth muscle cell (VSMC) proliferation. This study will determine, first, if the mitochondrial or cytoplasmic localization of Hsp60 is critical to VSMC proliferation and, second, the mechanism of Hsp60
Bor-Hwang Kang et al.
Scientific reports, 9(1), 8932-8932 (2019-06-22)
Buccal mucosa squamous cell carcinoma (BMSCC) is one of major subsites of oral cancer and is associated with a high rate of metastasis and poor prognosis. Heat shock proteins (HSPs) act as potential prognostic biomarkers in many cancer types. However
Sharmin Afroz et al.
Virus research, 261, 37-49 (2018-12-15)
The UL47 gene product, VP8, is a major tegument protein of BoHV-1. While VP8 is not essential for virus replication in cell culture, a UL47-deleted virus exhibits a smaller tegument structure and is avirulent in cattle. To obtain pure VP8
Shalini Swaroop et al.
Journal of neuroinflammation, 15(1), 177-177 (2018-06-11)
Interleukin-1β (IL-1β) is one of the most important cytokine secreted by activated microglia as it orchestrates the vicious cycle of inflammation by inducing the expression of various other pro-inflammatory cytokines along with its own production. Microglia-mediated IL-1β production is a
Hiroyuki Hosokawa et al.
The Journal of biological chemistry, 290(21), 13095-13103 (2015-04-12)
Gata3 acts as a master regulator for T helper 2 (Th2) cell differentiation by inducing chromatin remodeling of the Th2 cytokine loci, accelerating Th2 cell proliferation, and repressing Th1 cell differentiation. Gata3 also directly transactivates the interleukin-5 (Il5) gene via

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service