Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCATTCATGTTGCAGCAGTCTACAAATCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCATTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTGGGTGCTGGAAATGGAAACCTGCAAGGACCTAGACACATGCAGAAAGGCAGAGTGGAAACTAGCAGAGTTGTTCACATCATGGATTTTCAACGAGGGAAAAACTTGAGATACCAGCTATTACAGCTGGTAGAACCATTTGGAGTCATTTCAAATCATCTGATTCTAAATAAAATTAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MATR3(9782)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haruka Kuriyama et al.
Journal of dermatological science, 100(2), 110-119 (2020-09-19)
A previous study revealed that matrin-3 is an essential component in maintaining fibroblast growth factor 2 (FGF2)-mediated undifferentiation of neural stem cells (NSCs) using a proteomics approach. Malignant melanoma (MM) arises from melanocytes that originate from neural crest stem cells
Su-Hyun Nho et al.
Oncology reports, 41(1), 333-340 (2018-10-16)
Licochalcone H (LCH) is a chemical compound that is a positional isomer of licochalcone C (LCC), a chalconoid isolated from the root of Glycyrrhiza inflata, which has various pharmacological properties including anti‑inflammatory, antioxidant, antitumor, and anticancer effects. However, the efficacy of LCH
Ambra Sarracino et al.
mBio, 9(6) (2018-11-15)
Posttranscriptional regulation of HIV-1 replication is finely controlled by viral and host factors. Among the former, Rev controls the export of partially spliced and unspliced viral RNAs from the nucleus and their translation in the cytoplasm or incorporation into new
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU113801-20UG | 04061831358711 |
| EHU113801-50UG | 04061828400423 |