Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KRT18(3875)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hyunee Yim et al.
Journal of Korean medical science, 21(4), 652-655 (2006-08-08)
Cytokeratin 18 (CK18) protein was identified as an airway epithelial cell autoantigen associated with nonallergic asthma. Cleavage of CK18 protein by caspase-3 is a marker of early apoptosis in epithelial cells. It has been shown that the expression of active
Francescopaolo Di Cello et al.
Molecular cancer, 12, 90-90 (2013-08-08)
Recent epidemiological studies demonstrate that both active and involuntary exposure to tobacco smoke increase the risk of breast cancer. Little is known, however, about the molecular mechanisms by which continuous, long term exposure to tobacco smoke contributes to breast carcinogenesis
Hyejung Jung et al.
Molecular and cellular biochemistry, 423(1-2), 21-28 (2016-11-04)
During epithelial-mesenchymal transition (EMT), epithelial cells lose key phenotypic markers (e.g., E-cadherin and cytokeratin 18) and acquire mesenchymal markers (e.g., N-cadherin and vimentin). Although the loss of cytokeratin 18 is a hallmark of EMT, the regulatory role of cytokeratin 18
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU113871-20UG | 04061828614219 |
| EHU113871-50UG | 04061828379170 |