Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PARK7(11315)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Hua-Zong Zeng et al.
International journal of molecular sciences, 12(6), 3489-3499 (2011-07-13)
The aim of study is to identify cisplatin-resistance associated biomarkers for non-small cell lung cancers (NSCLC). We use two-dimensional electrophoresis (2-DE) combined with MALDI-TOF mass spectrometry to compare the proteome between lung cancer cell line A549 and its cisplatin-resistant subline
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU113961-20UG | 04061831358773 |
| EHU113961-50UG | 04061828379255 |