Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGGAGAAGTGGCTAAGGAGTGGCAGGAGCTGGATGACGCAGAGAAGGTCCAGCGGGAGCCTCTGCTCACTCTGGTGAAGGAAATCGTCCCCTATAACATGGCCCACAATGCAGAGCATGAGGCTTGCGACCTGCTTATGGAAATTGAGCAGGTGGACATGCTGGAGAAGGACATTGATGAAAATGCATATGCAAAGGTCTGCCTTTATCTCACCAGTTGTGTGAATTACGTGCCTGAGCCTGAGAACTCAGCCCTACTGCGTTGTGCCCTGGGTGTGTTCCGAAAGTTTAGCCGCTTCCCTGAAGCTCTGAGATTGGCATTGATGCTCAATGACATGGAGTTGGTAGAAGACATCTTCACCTCCTGCAAGGATGTGGTAGTACAGAAACAGATGGCATTCATGCTAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PSMD2(5708)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Peter Tsvetkov et al.
Nature chemical biology, 15(7), 681-689 (2019-05-28)
The mechanisms by which cells adapt to proteotoxic stress are largely unknown, but are key to understanding how tumor cells, particularly in vivo, are largely resistant to proteasome inhibitors. Analysis of cancer cell lines, mouse xenografts and patient-derived tumor samples
Evert Njomen et al.
Cell chemical biology, 26(9), 1283-1294 (2019-07-23)
The proteolytic arm of the protein homeostasis network is maintained by both the ubiquitin-proteasome system (UPS) and autophagy. A well-balanced crosstalk between the two catabolic pathways ensures energy-efficient maintenance of cellular function. Our current understanding of the crosstalk between the
Christoph Gerhardt et al.
The Journal of cell biology, 210(1), 115-133 (2015-07-08)
Mutations in RPGRIP1L result in severe human diseases called ciliopathies. To unravel the molecular function of RPGRIP1L, we analyzed Rpgrip1l(-/-) mouse embryos, which display a ciliopathy phenotype and die, at the latest, around birth. In these embryos, cilia-mediated signaling was
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU114041-50UG | 04061831374919 |
| EHU114041-20UG | 04061828614349 |