Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FTH1(2495)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Vagisha Ravi et al.
PloS one, 14(9), e0221952-e0221952 (2019-09-07)
Elevated expression of the iron regulatory protein, ferritin heavy chain 1 (FTH1), is increasingly being associated with high tumor grade and poor survival outcomes in glioblastoma. Glioma initiating cells (GICs), a small population of stem-like cells implicated in therapeutic resistance
Katalin Éva Sikura et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 413-431 (2019-02-01)
Objective- Calcific aortic valve disease is a prominent finding in elderly and in patients with chronic kidney disease. We investigated the potential role of iron metabolism in the pathogenesis of calcific aortic valve disease. Approach and Results- Cultured valvular interstitial
Caitlin W Brown et al.
Developmental cell, 51(5), 575-586 (2019-11-19)
Ferroptosis, regulated cell death characterized by the iron-dependent accumulation of lethal lipid reactive oxygen species, contributes to tissue homeostasis and numerous pathologies, and it may be exploited for therapy. Cells differ in their sensitivity to ferroptosis, however, and a key
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU114171-20UG | 04061831358797 |
| EHU114171-50UG | 04061828379453 |