Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCCCAAGAAGGTTCGATTGAGTGAAACAGACTTCAAAGTTATGGCAAGAGATGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTACAAGCTTTGGAGGGCAAGTACACAGATCTTAACTCTAATGATGTAACTGGCCTAAGAGAGTCTGAAGAAAAACTAAAGCAACAACAGCAGGAGTCTGCACGCAGGGAAAACATCCTTGTAATGCGACTAGCAACCAAGGAACAAGAGATGCAAGAGTGTACTACTCAAATCCAGTACCTCAAGCAAGTCCAGCAGCCGAGCGTTGCCCAACTGAGATCAACAATGGTAGACCCAGCGATCAACTTGTTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAACAAGCCCAAAATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... WTAP(9589)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jinliang Xue et al.
Human cell, 34(2), 502-514 (2020-11-25)
Esophageal squamous cell carcinoma (ESCC) is one of the most frequent malignancies worldwide. miR-193a-3p acts as an oncogene or tumor suppressor in different cancers. However, the functional role and regulatory mechanism of miR-193a-3p in ESCC remain to be elucidated. Our
Han Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 133, 111075-111075 (2021-01-01)
N6-methyladenosine (m6A) is one of the most abundant messenger RNAs modification. Increasing evidence illustrates its critical role on gastric cancer. Here, present research focuses on the potential function of m6A methyltransferase Wilms' tumour 1-associated protein (WTAP) in gastric cancer tumorigenesis.
Masatoshi Kobayashi et al.
Molecular and cellular biology, 38(16) (2018-06-06)
Adipocyte differentiation is regulated by various mechanisms, of which mitotic clonal expansion (MCE) is a key step. Although this process is known to be regulated by cell cycle modulators, the precise mechanism remains unclear. N6-Methyladenosine (m6A) posttranscriptional RNA modification, whose
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU115481-50UG | 04061828390175 |
| EHU115481-20UG | 04061831358988 |