Skip to Content
Merck
CN

EHU115481

MISSION® esiRNA

targeting human WTAP

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCCAAGAAGGTTCGATTGAGTGAAACAGACTTCAAAGTTATGGCAAGAGATGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTACAAGCTTTGGAGGGCAAGTACACAGATCTTAACTCTAATGATGTAACTGGCCTAAGAGAGTCTGAAGAAAAACTAAAGCAACAACAGCAGGAGTCTGCACGCAGGGAAAACATCCTTGTAATGCGACTAGCAACCAAGGAACAAGAGATGCAAGAGTGTACTACTCAAATCCAGTACCTCAAGCAAGTCCAGCAGCCGAGCGTTGCCCAACTGAGATCAACAATGGTAGACCCAGCGATCAACTTGTTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAACAAGCCCAAAATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... WTAP(9589)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinliang Xue et al.
Human cell, 34(2), 502-514 (2020-11-25)
Esophageal squamous cell carcinoma (ESCC) is one of the most frequent malignancies worldwide. miR-193a-3p acts as an oncogene or tumor suppressor in different cancers. However, the functional role and regulatory mechanism of miR-193a-3p in ESCC remain to be elucidated. Our
Han Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 133, 111075-111075 (2021-01-01)
N6-methyladenosine (m6A) is one of the most abundant messenger RNAs modification. Increasing evidence illustrates its critical role on gastric cancer. Here, present research focuses on the potential function of m6A methyltransferase Wilms' tumour 1-associated protein (WTAP) in gastric cancer tumorigenesis.
Masatoshi Kobayashi et al.
Molecular and cellular biology, 38(16) (2018-06-06)
Adipocyte differentiation is regulated by various mechanisms, of which mitotic clonal expansion (MCE) is a key step. Although this process is known to be regulated by cell cycle modulators, the precise mechanism remains unclear. N6-Methyladenosine (m6A) posttranscriptional RNA modification, whose
Yang Liu et al.
Science (New York, N.Y.), 365(6458), 1171-1176 (2019-08-24)
Host cell metabolism can be modulated by viral infection, affecting viral survival or clearance. Yet the cellular metabolism rewiring mediated by the N6-methyladenosine (m6A) modification in interactions between virus and host remains largely unknown. Here we report that in response

Global Trade Item Number

SKUGTIN
EHU115481-50UG04061828390175
EHU115481-20UG04061831358988

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service