Skip to Content
Merck
CN

EHU115751

MISSION® esiRNA

targeting human PRMT1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jong-Hyun Nho et al.
Biochemical and biophysical research communications, 530(2), 389-395 (2020-06-14)
Recent studies have revealed that protein arginine methyltransferases (PRMTs) are responsible for diverse neurodegenerative diseases. However, their pathophysiological role in dopaminergic neuronal death in Parkinson's disease (PD) has not been evaluated. In this study, we demonstrated that 1-Methyl-4-phenylpyridinium iodide (MPP+)
Eun-Kyung Moon et al.
The Korean journal of parasitology, 55(2), 109-114 (2017-05-17)
Protein arginine methyltransferase (PRMT) is an important epigenetic regulator in eukaryotic cells. During encystation, an essential process for
Weiqi Zhai et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 11-22 (2020-11-27)
Protein arginine methyltransferase-1 (PRMT1) is an important epigenetic regulator of cell function and contributes to inflammation and remodeling in asthma in a cell type-specific manner. Disease-specific expression patterns of microRNAs (miRNA) are associated with chronic inflammatory lung diseases, including asthma.
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service