Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTATTGCCGAGATGTTGCTGAAATGTATGACAATATCCTTCACAAACCCCTAAGTTTGAGGCCAGGAGTGAGTCTTACAGCCTGGTCCATTCTGGAAGAACTCCTAGAAAAAGACAGGCAAAATCGACTTGGTGCCAAGGAAGACTTTCTTGAAATTCAGAATCATCCTTTTTTTGAATCACTCAGCTGGGCTGACCTTGTACAAAAGAAGATTCCACCACCATTTAATCCTAATGTGGCTGGACCAGATGATATCAGAAACTTTGACACAGCATTTACAGAAGAAACAGTTCCATATTCTGTGTGTGTATCTTCTGACTATTCTATAGTGAATGCCAGTGTATTGGAGGCAGATGATGCATTCGTTGGTTTCTCTTATGCACCTCCTTCAGAAGACTTATTTTTGTGAGCAGTTTGCCATTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SGK3(100533105), SGK3(23678)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuanzhong Wang et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(8), E1500-E1508 (2017-02-09)
Many estrogen receptor alpha (ERα)-positive breast cancers initially respond to aromatase inhibitors (AIs), but eventually acquire resistance. Here, we report that serum- and glucocorticoid-inducible kinase 3 (SGK3), a kinase transcriptionally regulated by ERα in breast cancer, sustains ERα signaling and
Laura Creevey et al.
Molecular cancer therapeutics, 18(10), 1731-1743 (2019-07-11)
Divergent roles for androgen receptor (AR) in breast cancer have been reported. Following aromatase inhibitor (AI) treatment, the conversion of circulating androgens into estrogens can be diminished by >99%. We wished to establish whether the steroid environment can dictate the
Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| 35840-500ML | 04061831812817 |
| EHU116541-50UG | 04061828305193 |
| EHU116541-20UG | 04061828537693 |