Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGTTTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGCTTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCTGACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCACCGATGCCAGAGAGAATATCCAGAGATTCTTTGGCCATGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SAA1(6288)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
S L Wood et al.
British journal of cancer, 103(1), 101-111 (2010-06-10)
In renal cell carcinoma (RCC), the discovery of biomarkers for clinical use is a priority. This study aimed to identify and validate diagnostic and prognostic serum markers using proteomic profiling. Pre-operative sera from 119 patients with clear cell RCC and
Prasanth Puthanveetil et al.
Journal of cellular and molecular medicine, 19(6), 1418-1425 (2015-03-20)
To examine whether the long non-coding RNA (lncRNA) metastasis associated lung adenocarcinoma transcript 1 (MALAT1) is altered in the endothelial cells in response to glucose and the significance of such alteration. We incubated human umbilical vein endothelial cells with media
Carlos Martín Ardila et al.
Journal of periodontal & implant science, 45(1), 14-22 (2015-02-28)
The purpose of this study was to compare serum amyloid A (SAA) protein levels with high-sensitive C-reactive protein (hs-CRP) levels as markers of systemic inflammation in patients with chronic periodontitis. The association of serum titers of antibodies to periodontal microbiota
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU117611-20UG | 04061828551613 |
| EHU117611-50UG | 04061828316168 |