Skip to Content
Merck
CN

EHU117611

MISSION® esiRNA

targeting human SAA1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGCTTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCTGACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCACCGATGCCAGAGAGAATATCCAGAGATTCTTTGGCCATGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S L Wood et al.
British journal of cancer, 103(1), 101-111 (2010-06-10)
In renal cell carcinoma (RCC), the discovery of biomarkers for clinical use is a priority. This study aimed to identify and validate diagnostic and prognostic serum markers using proteomic profiling. Pre-operative sera from 119 patients with clear cell RCC and
Prasanth Puthanveetil et al.
Journal of cellular and molecular medicine, 19(6), 1418-1425 (2015-03-20)
To examine whether the long non-coding RNA (lncRNA) metastasis associated lung adenocarcinoma transcript 1 (MALAT1) is altered in the endothelial cells in response to glucose and the significance of such alteration. We incubated human umbilical vein endothelial cells with media
Carlos Martín Ardila et al.
Journal of periodontal & implant science, 45(1), 14-22 (2015-02-28)
The purpose of this study was to compare serum amyloid A (SAA) protein levels with high-sensitive C-reactive protein (hs-CRP) levels as markers of systemic inflammation in patients with chronic periodontitis. The association of serum titers of antibodies to periodontal microbiota

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service