Skip to Content
Merck
CN

EHU119251

MISSION® esiRNA

targeting human KLF15

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAACTTCTCGTCGCCAAAATGCCCAGTTGGGTATCTGGGTGATAGGCTGGTTGGCCGGCGGGCATATCACATGCTGCCCTCACCCGTCTCTGAAGATGACAGCGATGCCTCCAGCCCCTGCTCCTGTTCCAGTCCCGACTCTCAAGCCCTCTGCTCCTGCTATGGTGGAGGCCTGGGCACCGAGAGCCAGGACAGCATCTTGGACTTCCTATTGTCCCAGGCCACGCTGGGCAGTGGCGGGGGCAGCGGCAGTAGCATTGGGGCCAGCAGTGGCCCCGTGGCCTGGGGGCCCTGGCGAAGGGCAGCGGCCCCTGTGAAGGGGGAGCATTTCTGCTTGCCCGAGTTTCCTTTGGGTGATCCTGATGACGTCCCACGGCCCTTCCAGCCTACCCTGGAGGAGATTGAAGAGTTTCTGGAGGAGAACATGGAGCCTGGAGTCAAGGAGGTCCCTGAGGGCAACAGCAAGGACTTGGATGCCTGCAGCCAGCTCTCAGCTGGGCCACACAAGAGCCACCTCCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi-Yeon Yu et al.
Experimental cell research, 386(1), 111706-111706 (2019-11-08)
Krüppel-like factor 15 (KLF15) is a well-known transcription factor associated with podocyte injury and fibrosis. Recently, hypertensive nephropathy was discovered to be closely related to podocyte injury and fibrosis. However, methods to stimulate hypertension in vitro are lacking. Here, we
Deepesh Pandey et al.
Arteriosclerosis, thrombosis, and vascular biology, 38(4), 913-926 (2018-02-24)
KLF15 (Kruppel-like factor 15) has recently been shown to suppress activation of proinflammatory processes that contribute to atherogenesis in vascular smooth muscle, however, the role of KLF15 in vascular endothelial function is unknown. Arginase mediates inflammatory vasculopathy and vascular injury
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer
Seung Seok Han et al.
International journal of molecular medicine, 42(3), 1593-1602 (2018-06-15)
Krüppel‑like factor 15 (KLF15), also known as kidney‑enriched transcription factor, is known to participate in podocyte differentiation. However, the role of KLF15 in chronic podocyte injury remains incompletely understood, particularly in proteinuric disease models. In the present study, the 5/6 nephrectomy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service