Skip to Content
Merck
CN

EHU119261

MISSION® esiRNA

targeting human PTGER2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGAGGTCAGTAGTTTAAAAGTTCTTAGTTATATAGCATCTGGAAGATCATTTTGAAATTGTTCCTTGGAGAAATGAAAACAGTGTGTAAACAAAATGAAGCTGCCCTAATAAAAAGGAGTATACAAACATTTAAGCTGTGGTCAAGGCTACAGATGTGCTGACAAGGCACTTCATGTAAAGTGTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qian Zhang et al.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, 34(4), 606-617 (2018-07-10)
Secondary hyperparathyroidism (SHPT) in patients with end-stage renal disease (ESRD) is characterized by hyperplasia of the parathyroid glands (PTGs), while the underlying mechanism is not completely understood. Previously we demonstrated a relationship between cyclooxygenase 2 (COX2) overexpression and parathyroid hyperplasia
Fusako Sakai-Takemura et al.
Communications biology, 3(1), 182-182 (2020-04-22)
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release
Jigisha A Patel et al.
International journal of molecular sciences, 19(8) (2018-08-15)
Prostacyclins are extensively used to treat pulmonary arterial hypertension (PAH), a life-threatening disease involving the progressive thickening of small pulmonary arteries. Although these agents are considered to act therapeutically via the prostanoid IP receptor, treprostinil is the only prostacyclin mimetic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service