Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGAACAAGAAGGTGAGCAAGATGGAAATCCTGCAGCACGTCATCGACTACATCTTGGACCTGCAGATCGCCCTGGACTCGCATCCCACTATTGTCAGCCTGCATCACCAGAGACCCGGGCAGAACCAGGCGTCCAGGACGCCGCTGACCACCCTCAACACGGATATCAGCATCCTGTCCTTGCAGGCTTCTGAATTCCCTTCTGAGTTAATGTCAAATGACAGCAAAGCACTGTGTGGCTGAATAAGCGGTGTTCATGATTTCTTTTATTCTTTGCACAACAACAACAACAACAAATTCACGGAATCTTTTAAGTGCTGAACTTATTTTTCAACCATTTCACAAGGAGGACAAGTTGAATGGACCTTTTTAAAAAGAAAAAAAAAATGGAAGGAAAACTAAGAATGATCATCTTCCCAGGGTGTTCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ID2(3398)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yin Liu et al.
Breast cancer research and treatment, 175(1), 77-90 (2019-02-07)
Ductal carcinoma in situ (DCIS) is a non-invasive form of breast cancer which could progress to or recur as invasive breast cancer. The underlying molecular mechanism of DCIS progression is yet poorly understood, and appropriate biomarkers to distinguish benign form
Yilin Pan et al.
Molecular immunology, 128, 106-115 (2020-10-31)
The aims of the present study were to investigate the signaling mechanisms for sphingosine-1-phosphate (S1P)-induced airway smooth muscle cells (ASMCs) proliferation and to explore the effect of activation of adenosine monophosphate-activated protein kinase (AMPK) on S1P-induced ASMCs proliferation and its
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU119651-20UG | 04061828553426 |
| EHU119651-50UG | 04061828317851 |