Skip to Content
Merck
CN

EHU121191

MISSION® esiRNA

targeting human DES

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human DES

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | human accession no.

ENSG00000175084

NCBI accession no.

NM_001927

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... DES(1674), DES(1674)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nobuyuki Hinata et al.
BioMed research international, 2014, 906921-906921 (2014-05-31)
Detailed knowledge of the anatomy of the rhabdosphincter and adjacent tissues is mandatory during urologic surgery to ensure reliable oncologic and functional outcomes. To characterize the levator ani (LA) function for the urethral sphincter, we described connective tissue morphology between
Christoph Daniel et al.
PloS one, 8(12), e83846-e83846 (2014-01-01)
We recently identified Thrombospondin-2 (TSP-2) as a regulator of matrix remodelling and inflammation in experimental kidney disease by using TSP-2 null mice and successfully proved TSP-2 overexpression as a therapeutic concept in a short term glomerulonephritis model in the rat.
Shogo Hayashi et al.
Anatomy & cell biology, 46(2), 149-156 (2013-07-23)
The supinator muscle originates from the annular ligament of the radius, and the muscle fibers and ligament take a similar winding course. Likewise, the coccygeus muscle and the sacrospinous ligament are attached together, and show a similar fiber orientation. During
Yusuke Kinugasa et al.
Yonsei medical journal, 53(4), 849-855 (2012-06-06)
We recently demonstrated the morphology of the anococcygeal ligament. As the anococcygeal ligament and raphe are often confused, the concept of the anococcygeal raphe needs to be re-examined from the perspective of fetal development, as well as in terms of
Xiao-Mei Lao et al.
Oncology letters, 11(3), 2027-2034 (2016-03-22)
Inflammation and desmoplasia are frequently identified in the tumor microenvironment, and have been demonstrated to be effective modulators of malignant biological events. However, the mechanisms by which the inflammatory microenvironment and interstitial fibrosis interact with one another remain to be
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service