Skip to Content
Merck
CN

EHU121191

MISSION® esiRNA

targeting human DES

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji Hyun Kim et al.
Anatomy & cell biology, 49(1), 50-60 (2016-04-07)
Fetal development of the face involves a specific type of cornification in which keratinocytes provide a mass or plug to fill a cavity. The epithelial-mesenchymal interaction was likely to be different from that in the usual skin. We examined expression
Christoph Daniel et al.
PloS one, 8(12), e83846-e83846 (2014-01-01)
We recently identified Thrombospondin-2 (TSP-2) as a regulator of matrix remodelling and inflammation in experimental kidney disease by using TSP-2 null mice and successfully proved TSP-2 overexpression as a therapeutic concept in a short term glomerulonephritis model in the rat.
Shogo Hayashi et al.
Anatomy & cell biology, 46(2), 149-156 (2013-07-23)
The supinator muscle originates from the annular ligament of the radius, and the muscle fibers and ligament take a similar winding course. Likewise, the coccygeus muscle and the sacrospinous ligament are attached together, and show a similar fiber orientation. During
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl
Yusuke Kinugasa et al.
Yonsei medical journal, 53(4), 849-855 (2012-06-06)
We recently demonstrated the morphology of the anococcygeal ligament. As the anococcygeal ligament and raphe are often confused, the concept of the anococcygeal raphe needs to be re-examined from the perspective of fetal development, as well as in terms of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service