Skip to Content
Merck
CN

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | human accession no.

ENSG00000175084

NCBI accession no.

NM_001927

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DES(1674), DES(1674)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji Hyun Kim et al.
Anatomy & cell biology, 46(4), 272-284 (2014-01-05)
Carbonic anhydrase type IX (CA9) is known to express in the fetal joint cartilage to maintain pH against hypoxia. Using paraffin-embedded histology of 10 human fetuses at 10-16 weeks of gestation with an aid of immunohistochemistry of the intermediate filaments
Monica Gunetti et al.
PloS one, 7(9), e45538-e45538 (2012-10-03)
Urinary incontinence, defined as the complaint of any involuntary loss of urine, is a pathological condition, which affects 30% females and 15% males over 60, often following a progressive decrease of rhabdosphincter cells due to increasing age or secondary to
Nobuyuki Hinata et al.
BioMed research international, 2014, 906921-906921 (2014-05-31)
Detailed knowledge of the anatomy of the rhabdosphincter and adjacent tissues is mandatory during urologic surgery to ensure reliable oncologic and functional outcomes. To characterize the levator ani (LA) function for the urethral sphincter, we described connective tissue morphology between
Xiao-Mei Lao et al.
Oncology letters, 11(3), 2027-2034 (2016-03-22)
Inflammation and desmoplasia are frequently identified in the tumor microenvironment, and have been demonstrated to be effective modulators of malignant biological events. However, the mechanisms by which the inflammatory microenvironment and interstitial fibrosis interact with one another remain to be
Ji Hyun Kim et al.
Anatomy & cell biology, 49(1), 50-60 (2016-04-07)
Fetal development of the face involves a specific type of cornification in which keratinocytes provide a mass or plug to fill a cavity. The epithelial-mesenchymal interaction was likely to be different from that in the usual skin. We examined expression
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service