Skip to Content
Merck
CN

EHU122021

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX7, CTD-2135J3.4

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCAATGAATTCGACCAGTATTTGAACACTCCTGGCCACCCAGACTCCGCCACAGGGGCCATGGCCCTCAGTGGGCATGTTCCGGTCTCCCAGGTGACACCAACGGGTCCCACAGAGACCAGCCTCATCTCCGTCCTGGCTGATGCCACGGCCACGTACTACAACAGCTACAGTGTGTCATAGAGCTGGAGGCGCCCCGTCCGGTCAGCCCTCGCGCCCTCTCCTTCTTGTGCCTTGAGTGGCAGAGGAGCCGTCCAGCCACACCAGCTTTCCTCCCACCGCTCAGGGCAGGGAGGTCTGAACTGCGGCCCCAGAGCCTTTGGCCTAAGCTGGACTCTCCTTATCCGAGTGCCGCCTCTATCCCCTTCCCCACGTTCCAGCCCCTGCAGCCCACATTTTAAGTATATTCCTTCAAGTGAGTTTTCCTCCAGCCCCTGAGAGTTGCTGTCTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yumei Wang et al.
Cancer biomarkers : section A of Disease markers, 27(1), 85-94 (2019-11-07)
Breast cancer has become a major threat to women's physical and mental health. Many long noncoding RNAs (lncRNAs) have been reported to exert effect in the progression of breast cancer. However, the regulatory mechanism of HAND2-AS1 remains unclear. Therefore, this
Wei Peng et al.
The Prostate, 79(4), 370-378 (2018-11-30)
PSMA expression in the prostate epithelium is controlled by a cis-element, PSMA enhancer (PSME). PSME contains multiple binding sites for Sox proteins, and in this study, we identified Sox7 protein as a negative regulator of PSMA expression through its interaction
Lu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 254-263 (2018-06-30)
SOX7 (SRY-related high mobility group box 7), a high mobility group protein, is reported to be down-regulated in several cancer types, which indicates an important role in tumorigenesis; however, its biologic role in renal cell carcinoma (RCC) pathogenesis remains unknown.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service