Skip to Content
Merck
CN

EHU122721

MISSION® esiRNA

targeting human HMGA1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAGCCAAACTGTCTTTGTCACCACGTGGGGCTCACTTTTCATCCTTCCCCAACTTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAGGAAGGCAGGAGGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCCTGGGATCTGAGTACATATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTGAGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGGGGCTGCTCCCCTAACCCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATAACAAGGAGCTCACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCCAAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAACTACCTCTGGACAGTTGTGTTGTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dae Kyoung Kim et al.
Experimental & molecular medicine, 48, e255-e255 (2016-08-27)
Cancer stem cells are a subpopulation of cancer cells characterized by self-renewal ability, tumorigenesis and drug resistance. The aim of this study was to investigate the role of HMGA1, a chromatin remodeling factor abundantly expressed in many different cancers, in
Liqian Zhu et al.
Virus research, 238, 236-242 (2017-07-08)
Bovine herpesvirus 1 (BoHV-1) is an important pathogen of cattle that causes clinical symptoms in the upper respiratory tract and conjunctivitis. Like most alpha-herpesvirinae subfamily members, BoHV-1 establishes latency in sensory neurons. Stress consistently induces reactivation from latency, which is
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service