Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGGAATGACAAAGCTTGCTTTTCTGGTATGTTCTAGGTGTATTGTGACTTTTACTGTTATATTAATTGCCAATATAAGTAAATATAGATTATATATGTATAGTGTTTCACAAAGCTTAGACCTTTACCTTCCAGCCACCCCACAGTGCTTGATATTTCAGAGTCAGTCATTGGTTATACATGTGTAGTTCCAAAGCACATAAGCTAGAAGAAGAAATATTTCTAGGAGCACTACCATCTGTTTTCAACATGAAATGCCACACACATAGAACTCCAACATCAATTTCATTGCACAGACTGACTGTAGTTAATTTTGTCACAGAATCTATGGACTGAATCTAATGCTTCCAAAAATGTTGTTTGTTTGCAAATATCAAACATTGTTATGCAAGAAATTATTAATTACAAAATGAAGATTTATACCATTGTGGTTTAAGCTGTACTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RTN4(57142)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yu-Jie Chen et al.
The Journal of cell biology, 219(2) (2020-01-03)
Escape of large macromolecular complexes from the endoplasmic reticulum (ER), such as a viral particle or cellular aggregate, likely induces mechanical stress initiated on the luminal side of the ER membrane, which may threaten its integrity. How the ER responds
Jiajia Cui et al.
Journal of controlled release : official journal of the Controlled Release Society, 304, 259-267 (2019-05-06)
Degradable poly(amine-co-ester) (PACE) terpolymers hold tremendous promise for siRNA delivery because these materials can be formulated into delivery vehicles with highly efficient siRNA encapsulation, providing effective knockdown with low toxicity. Here, we demonstrate that PACE nanoparticles (NPs) provide substantial protein
Jin-Kyu Park et al.
Hepatology (Baltimore, Md.), 65(5), 1720-1734 (2017-01-17)
Nogo-B (Reticulon 4B) is an endoplasmic reticulum (ER) resident protein that regulates ER structure and function. Because ER stress is known to induce M2 macrophage polarization, we examined whether Nogo-B regulates M1/M2 polarization of Kupffer cells and alters the pathogenesis
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU123481-20UG | 04061828582846 |
| EHU123481-50UG | 04061828357451 |