Skip to Content
Merck
CN

EHU123481

MISSION® esiRNA

targeting human RTN4

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAATGACAAAGCTTGCTTTTCTGGTATGTTCTAGGTGTATTGTGACTTTTACTGTTATATTAATTGCCAATATAAGTAAATATAGATTATATATGTATAGTGTTTCACAAAGCTTAGACCTTTACCTTCCAGCCACCCCACAGTGCTTGATATTTCAGAGTCAGTCATTGGTTATACATGTGTAGTTCCAAAGCACATAAGCTAGAAGAAGAAATATTTCTAGGAGCACTACCATCTGTTTTCAACATGAAATGCCACACACATAGAACTCCAACATCAATTTCATTGCACAGACTGACTGTAGTTAATTTTGTCACAGAATCTATGGACTGAATCTAATGCTTCCAAAAATGTTGTTTGTTTGCAAATATCAAACATTGTTATGCAAGAAATTATTAATTACAAAATGAAGATTTATACCATTGTGGTTTAAGCTGTACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Jie Chen et al.
The Journal of cell biology, 219(2) (2020-01-03)
Escape of large macromolecular complexes from the endoplasmic reticulum (ER), such as a viral particle or cellular aggregate, likely induces mechanical stress initiated on the luminal side of the ER membrane, which may threaten its integrity. How the ER responds
Jiajia Cui et al.
Journal of controlled release : official journal of the Controlled Release Society, 304, 259-267 (2019-05-06)
Degradable poly(amine-co-ester) (PACE) terpolymers hold tremendous promise for siRNA delivery because these materials can be formulated into delivery vehicles with highly efficient siRNA encapsulation, providing effective knockdown with low toxicity. Here, we demonstrate that PACE nanoparticles (NPs) provide substantial protein
Jin-Kyu Park et al.
Hepatology (Baltimore, Md.), 65(5), 1720-1734 (2017-01-17)
Nogo-B (Reticulon 4B) is an endoplasmic reticulum (ER) resident protein that regulates ER structure and function. Because ER stress is known to induce M2 macrophage polarization, we examined whether Nogo-B regulates M1/M2 polarization of Kupffer cells and alters the pathogenesis
Dae-Gyun Ahn et al.
Cell cycle (Georgetown, Tex.), 14(14), 2301-2310 (2015-05-07)
Dysregulation of Ras signaling is the major cause of various cancers. Aberrant Ras signaling, however, provides a favorable environment for many viruses, making them suitable candidates as cancer-killing therapeutic agents. Susceptibility of cancer cells to such viruses is mainly due

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service