Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGCCTGCAGACACAACTCAAGGCTCAGAACAGCAGGATCCAGCAACTCTTCCACAAGGTGGCCCAGCAGCAGCGGCACCTGGAGAAGCAGCACCTGCGAATTCAGCATCTGCAAAGCCAGTTTGGCCTCCTGGACCACAAGCACCTAGACCATGAGGTGGCCAAGCCTGCCCGAAGAAAGAGGCTGCCCGAGATGGCCCAGCCAGTTGACCCGGCTCACAATGTCAGCCGCCTGCACCGGCTGCCCAGGGATTGCCAGGAGCTGTTCCAGGTTGGGGAGAGGCAGAGTGGACTATTTGAAATCCAGCCTCAGGGGTCTCCGCCATTTTTGGTGAACTGCAAGATGACCTCAGATGGAGGCTGGACAGTAATTCAGAGGCGCCACGATGGCTCAGTGGACTTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ANGPTL4(51129)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
William Yang et al.
Oncogene, 39(18), 3650-3665 (2020-03-07)
The BRAFV600E mutation occurs in more than 50% of cutaneous melanomas, and results in the constitutive activation of the mitogen-activated protein kinases (MAPK) pathway. MAP kinase-interacting serine/threonine-protein kinase 1 and 2 (MNK1/2) are downstream effectors of the activated MAPK pathway
Shinro Hata et al.
Oncology reports, 38(1), 120-128 (2017-06-01)
Angiopoietin-like protein 4 (ANGPTL4) is a multifunctional protein, playing roles in glucose and lipid metabolism, inflammation, angiogenesis, and tumorigenesis. Recent research suggests that ANGPTL4 is induced by hypoxia and is a useful diagnostic or prognostic marker for various cancers. However
Matthew R Richardson et al.
Angiogenesis, 17(3), 675-683 (2014-02-25)
Angiopoietin-like 2 (ANGPTL2) has been reported to induce sprouting angiogenesis; however, its role in vasculogenesis, the de novo lumenization of endothelial cells (EC), remains unexplored. We sought to investigate the potential role of ANGPTL2 in regulating human cord blood derived
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU123661-50UG | 04061828347964 |
| EHU123661-20UG | 04061831359411 |