Skip to Content
Merck
CN

EHU124231

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guangfen Mao et al.
Circulation, 136(10), 927-939 (2017-07-06)
PCTP (phosphatidylcholine transfer protein) regulates the intermembrane transfer of phosphatidylcholine. Higher platelet PCTP expression is associated with increased platelet responses on activation of protease-activated receptor 4 thrombin receptors noted in black subjects compared with white subjects. Little is known about
Wenjing Lang et al.
Experimental cell research, 374(1), 140-151 (2018-11-26)
High expression of the oncogene ecotropic viral integration site-1 (EVI-1) is an independent negative prognostic indicator of survival in leukemia patients. This study aimed to examine the effects of arsenic trioxide (ATO) on EVI-1 in acute myeloid leukemia (AML). Mononuclear
Tong Zhou et al.
EBioMedicine, 31, 217-225 (2018-05-16)
Renal fibrosis is widely considered a common mechanism leading to end-stage renal failure. Epithelial-to-mesenchymal transition (EMT) plays important roles in the pathogenesis of renal fibrosis. Runt-related transcription factor 1(RUNX1) plays a vital role in hematopoiesis via Endothelial-to-Hematopoietic Transition (EHT), a
Ken-ichi Takayama et al.
Oncotarget, 6(4), 2263-2276 (2014-12-30)
Androgen receptor (AR) signaling is essential for the development of prostate cancer. Here, we report that runt-related transcription factor (RUNX1) could be a key molecule for the androgen-dependence of prostate cancer. We found RUNX1 is a target of AR and
Chenghao Lu et al.
Pathology, research and practice, 216(11), 153142-153142 (2020-09-01)
Colorectal cancer (CRC) was one of the most malignant tumors worldwide due to its metastasis. Epithelial-to-mesenchymal transition (EMT) plays an important role in CRC migration, and transforming growth factor-β (TGF-β) works as a dominating cytokine in CRC EMT process. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service