Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jian Chen et al.
Cell death & disease, 8(10), e3090-e3090 (2017-10-06)
Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role
Sergei Boichuk et al.
Anti-cancer drugs, 29(6), 549-559 (2018-04-27)
The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that
Yu Sun et al.
Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)
MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their
Maud Toulmonde et al.
EBioMedicine, 62, 103131-103131 (2020-12-01)
Undifferentiated pleomorphic sarcoma (UPS) is the most frequent, aggressive and less-characterized sarcoma subtype. This study aims to assess UPS molecular characteristics and identify specific therapeutic targets. High-throughput technologies encompassing immunohistochemistry, RNA-sequencing, whole exome-sequencing, mass spectrometry, as well as radiomics were
Jan Rossaint et al.
The Journal of clinical investigation, 126(3), 962-974 (2016-02-16)
Chronic kidney disease (CKD) has been associated with impaired host response and increased susceptibility to infections. Leukocyte recruitment during inflammation must be tightly regulated to protect the host against pathogens. FGF23 levels are increased in blood during CKD, and levels
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service