Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTGGTGGAAGAAGAAGCAGTCTTTCTTATGAAGATGCTGACTGTGTTGTTATTATTGGAGGTGCATCAAATGAAGCAGGAAAATGGATGGATGATACCTGCGACAGTAAACGAGGCTACATATGCCAGACACGATCCGACCCTTCCTTGACTAATCCTCCAGCAACGATTCAAACAGATGGCTTTGTTAAATATGGCAAAAGCAGCTATTCACTCATGAGACAAAAATTTCAATGGCATGAAGCGGAGACATACTGCAAGCTTCACAATTCCCTTATAGCCAGCATTCTGGATCCCTACAGTAATGCATTTGCGTGGCTGCAGATGGAAACATCTAATGAACGTGTGTGGATCGCCCTGAACAGTAACTTGACTGATAATCAATACACTTGGACTGATAAGTGGAGGGTGAGGTACACTAACTGGGCTGCTGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MRC1(4360)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jinjian Huang et al.
Bioactive materials, 6(3), 770-782 (2020-10-08)
Herein, we report the synthesis of a biomimic hydrogel adhesive that addresses the poor healing of surgical anastomosis. Dopamine-conjugated xanthan gum (Da-g-Xan) is fabricated using deep insights into the molecular similarity between mussels' adhesive and dopamine as well as the
Gregor Olmes et al.
Arthritis research & therapy, 18, 90-90 (2015-01-01)
The role of macrophages in the pathogenesis of lupus nephritis, in particular their differentiation to a certain subtype (e.g., M1- or M2-like) modulating the inflammatory reaction, is unknown. Here we investigated whether the differentiation in M1- or M2-like macrophages depends
Tae-Wook Chung et al.
Oncotarget, 8(3), 4436-4448 (2016-12-30)
Tumor-derived gangliosides in the tumor microenvironment are involved in the malignant progression of cancer. However, the molecular mechanisms underlying the effects of gangliosides shed from tumors on macrophage phenotype remain unknown. Here, we showed that ganglioside GM1 highly induced the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU126811-50UG | 04061828358748 |
| EHU126811-20UG | 04061828594726 |