Skip to Content
Merck
CN

EHU126851

MISSION® esiRNA

targeting human CCR5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human CCR5

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Silvia Waldeck et al.
Molecular oncology, 14(4), 779-794 (2020-01-20)
FLT3-ITD tyrosine kinase inhibitors (TKI) show limited clinical activity in acute myeloid leukemia (AML) due to emerging resistance. TKI resistance is mediated by secondary FLT3-ITD mutations only in a minority of cases. We hypothesize that the cytokine CCL5 protects AML
Asim Pervaiz et al.
Journal of cancer research and clinical oncology, 147(1), 73-91 (2020-09-10)
Liver metastasis is observed in up to 50% of colorectal cancer (CRC) patients. Available treatment options are limited and disease recurrence is often. Chemokine receptor 5 (CCR5) has attracted attention as novel therapeutic target for treating cancers. In this study
Ying Wang et al.
Oncology reports, 36(6), 3522-3528 (2016-10-18)
Glioblastoma (GBM) is a highly malignant brain tumor characterized by invasion tendency. Macrophage infiltration is associated with GBM invasion, but the mechanisms remain unclear. Hypoxia is an outstanding characteristic of GBM tissue. Hypoxia microenvironment modulates the biological behaviors of both tumor
Sandra Zazo et al.
Molecular cancer therapeutics, 19(8), 1696-1707 (2020-05-15)
HER2-positive breast cancer is currently managed with chemotherapy in combination with specific anti-HER2 therapies, including trastuzumab. However, a high percentage of patients with HER2-positive tumors do not respond to trastuzumab (primary resistance) or either recur (acquired resistance), mostly due to
Ji Hoon Phi et al.
PloS one, 12(1), e0169714-e0169714 (2017-01-11)
The etiology and pathogenesis of moyamoya disease (MMD) are still obscure. Previous studies indicated that angiogenic chemokines may play an important role in the pathogenesis of the disease. Recently, it was discovered that peripheral blood-derived endothelial colony-forming cells (ECFCs) and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service