Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGCCAGCACTATGTGTACATGTTCCTGGTGAAATGGCAGGACCTGTCGGAGAAGGTGGTCTACCGGCGCTTCACCGAGATCTACGAGTTCCATAAAACCTTAAAAGAAATGTTCCCTATTGAGGCAGGGGCGATCAATCCAGAGAACAGGATCATCCCCCACCTCCCAGCTCCCAAGTGGTTTGACGGGCAGCGGGCCGCCGAGAACCGCCAGGGCACACTTACCGAGTACTGCGGCACGCTCATGAGCCTGCCCACCAAGATCTCCCGCTGTCCCCACCTCCTCGACTTCTTCAAGGTGCGCCCTGATGACCTCAAGCTCCCCACGGACAACCAGACAAAAAAGCCAGAGACATACTTGATGCCCAAAGATGGCAAGAGTACCGCGACAGACATCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NCF1(653361)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dehong Yan et al.
The Journal of experimental medicine, 217(2) (2019-10-31)
Myeloid-derived suppressor cells (MDSCs) are "polarized" myeloid cells that effectively promote tumorigenesis by inhibiting antitumor immunity. How myeloid cells acquire the protumoral properties during tumorigenesis is poorly understood. We report here that the polarity protein TIPE2 (tumor necrosis factor-α-induced protein
Hyo Jung Shin et al.
Polymers, 12(2) (2020-02-20)
Osteoarthritis (OA) is the most common joint disorder that has had an increasing prevalence due to the aging of the population. Recent studies have concluded that OA progression is related to oxidative stress and reactive oxygen species (ROS). ROS are
Bharatwaj Sowrirajan et al.
Scientific reports, 7, 43441-43441 (2017-02-28)
Interleukin (IL)-27, a member of the IL-12 cytokine family, plays an important and diverse role in the function of the immune system. We have previously demonstrated that IL-27 is an anti-viral cytokine which inhibits HIV-1, HIV-2, Influenza virus and herpes
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU127961-50UG | 04061828338870 |
| EHU127961-20UG | 04061828574391 |