Skip to Content
Merck
CN

EHU129441

Sigma-Aldrich

MISSION® esiRNA

targeting human PIAS1

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCACTTGTCCGACTGTCCACAACAGTACCAAACACGATTGTTGTTTCTTGGACTGCAGAAATTGGAAGAAACTATTCCATGGCAGTATATCTTGTAAAACAGTTGTCCTCAACAGTTCTTCTTCAGAGGTTACGAGCAAAGGGAATAAGGAATCCGGATCATTCTAGAGCTTTAATTAAAGAGAAGTTGACTGCGGATCCAGACAGTGAAATAGCTACAACCAGCCTAAGGGTTTCTCTACTATGTCCACTTGGTAAAATGCGGCTGACAATTCCGTGTCGGGCCCTTACATGTTCTCATCTACAATGTTTTGACGCAACTCTTTACATTCAGATGAATGAGAAAAAACCAACCTGGGTTTGTCCTGTCTGTGATAAGAAGGCTCCATATGAACACCTTATTATTGATGGCTTGTTTATGGAAATCCTAAAGTACTGTACAGACTGTGATGAAATACAATTTAAGGAGGATGGCACTTGGGCACCGATGAGATCAAAAAAGGAAGTACAGGAAGTTTCTGCCTCTTACAATGGAGTCGATGGATGCTTGAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hsiao-Yun Lin et al.
Journal of proteome research, 18(1), 182-190 (2018-10-24)
Stressful events promote psychopathogenic changes that might contribute to the development of mental illnesses. Some individuals tend to recover from the stress response, while some do not. However, the molecular mechanisms of stress resilience during stress are not well-characterized. Here
Yen-Chen Liu et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 29(1), 376-395 (2020-09-21)
The amyloid precursor protein (APP) intracellular domain (AICD) is implicated in the pathogenesis of Alzheimer's disease (AD), but post-translational modification of AICD has rarely been studied and its role in AD is unknown. In this study, we examined the role and
Yan-Chu Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(29), 9574-9589 (2014-07-18)
cAMP-responsive element binding protein (CREB) phosphorylation and signaling plays an important role in long-term memory formation, but other posttranslational modifications of CREB are less known. Here, we found that CREB1Δ, the short isoform of CREB, could be sumoylated by the
Min Li et al.
Nature communications, 6, 6720-6720 (2015-04-09)
DNA topoisomerase I (TOP1) has an important role in maintaining DNA topology by relaxing supercoiled DNA. Here we show that the K391 and K436 residues of TOP1 are SUMOylated by the PIAS1-SRSF1 E3 ligase complex in the chromatin fraction containing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service