Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGAATGAATGGAAAAGAACGTGCTCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATTGAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAAGACATTGAAATTATTCCAATCCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCAGAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATGACAGCTCTCCTTAAGTGATTTCTTCTGTTTTCTGTTTCCTTTTTTAAACATTAGTGTTCATAGCTTCCAAGAGACATGCTGACTTTCATTTCTTGAGGTACTCTGCACATACGCACCACATCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MS4A1(931)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract.
Yuto Sano et al.
The Journal of veterinary medical science, 78(2), 287-291 (2015-11-06)
Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of
Oriana Marques et al.
BMC cancer, 16, 187-187 (2016-03-06)
While the deregulation of iron homeostasis in breast epithelial cells is acknowledged, iron-related alterations in stromal inflammatory cells from the tumor microenvironment have not been explored. Immunohistochemistry for hepcidin, ferroportin 1 (FPN1), transferrin receptor 1 (TFR1) and ferritin (FT) was
Alessia Alunno et al.
Journal of cellular and molecular medicine, 19(7), 1689-1696 (2015-03-11)
It has been recently reported that telocytes, a stromal (interstitial) cell subset involved in the control of local tissue homeostasis, are hampered in the target organs of inflammatory/autoimmune disorders. Since no data concerning telocytes in minor salivary glands (MSGs) are
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU129481-20UG | 04061828681778 |
| EHU129481-50UG | 04061828456512 |