Skip to Content
Merck
CN

EHU130131

MISSION® esiRNA

targeting human CD83

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGCAACTCGGGGACATACAGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGCAAGGTGATCTTGAGAGTGACAGGATGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAATACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTATTTTCTACTTAACACTCATCATTTTCACTTGTAAGTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTCTAAAGCTGGCATGGAACGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCTCACAAGACAGAACTGGTATGAGCAGGATTTCTGCAGGTTCTTCTTCCTGAAGCTGAGGCTCAGGGGTGTGCCTGTCTGTTACACTGGAGGAGAGAAGAATGAGCCTACGCTGAAGATGGCATCCTGTGAAGTCCTTCACCTCACTGAAAACATCTGGAAGGGGATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S M Shamsul Islam et al.
Mediators of inflammation, 2019, 5761392-5761392 (2019-10-05)
Behçet's disease (BD) is an autoinflammatory disease that can lead to life- and sight-threating complications. Dendritic cells (DCs) are the most potent antigen-presenting cells that can regulate multiple inflammatory pathways. The objective of this study was to investigate the association
Shanshan Huo et al.
Developmental and comparative immunology, 99, 103398-103398 (2019-05-24)
Emerging evidence suggests that CD83, a dendritic cells (DCs) maturation marker in humans and mice, may prossess immunomodulatory capacities. Although porcine CD83 shares ∼75% sequence homology with its human counterpart, whether it functions as an immunoregulatory molecule remains unknown. To

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service