Skip to Content
Merck
CN

EHU131141

MISSION® esiRNA

targeting human CDH5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCTCTGATTGGCACAGTGCTGGCCATGGACCCTGATGCGGCTAGGCATAGCATTGGATACTCCATCCGCAGGACCAGTGACAAGGGCCAGTTCTTCCGAGTCACAAAAAAGGGGGACATTTACAATGAGAAAGAACTGGACAGAGAAGTCTACCCCTGGTATAACCTGACTGTGGAGGCCAAAGAACTGGATTCCACTGGAACCCCCACAGGAAAAGAATCCATTGTGCAAGTCCACATTGAAGTTTTGGATGAGAATGACAATGCCCCGGAGTTTGCCAAGCCCTACCAGCCCAAAGTGTGTGAGAACGCTGTCCATGGCCAGCTGGTCCTGCAGATCTCCGCAATAGACAAGGACATAACACCACGAAACGTGAAGTTCAAATTCATCTTGAATACTGAGAACAACTTTACCCTCACGGATAATCACGATAACACGGCCAACATCACAGTCAAGTATGGGCAGTTTGACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyong Wu et al.
American journal of translational research, 8(10), 4310-4319 (2016-11-11)
Angiotensin II (AngII) involved in the pathogenesis of pulmonary injury through impairing the integrity of pulmonary microvascular endothelial barrier, but the mechanism is still not clear. We aim to determine the roles of VE-cadherin, playing crucial roles in the adhesion
Miwa Sato et al.
PloS one, 10(9), e0137301-e0137301 (2015-09-04)
We developed a microfluidic model of microcirculation containing both blood and lymphatic vessels for examining vascular permeability. The designed microfluidic device harbors upper and lower channels that are partly aligned and are separated by a porous membrane, and on this
Natalia Colás-Algora et al.
Cellular and molecular life sciences : CMLS, 77(11), 2125-2140 (2019-08-10)
VE-cadherin plays a central role in controlling endothelial barrier function, which is transiently disrupted by proinflammatory cytokines such as tumor necrosis factor (TNFα). Here we show that human endothelial cells compensate VE-cadherin degradation in response to TNFα by inducing VE-cadherin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service