Skip to Content
Merck
CN

EHU132581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGATGGGAAGAGAGAACTCACACAGATGGAAGAATCTTCTACATAAATCACAATATAAAAAGAACACAATGGGAAGATCCTCGGTTGGAGAATGTAGCAATAACTGGACCAGCAGTGCCCTACTCCAGGGATTACAAAAGAAAGTATGAGTTCTTCCGAAGAAAGTTGAAGAAGCAGAATGACATTCCAAACAAATTTGAAATGAAACTTCGCCGAGCAACTGTTCTTGAAGACTCTTACCGGAGAATTATGGGTGTCAAGAGAGCAGACTTCCTGAAGGCTCGACTGTGGATTGAGTTTGATGGTGAAAAGGGATTGGATTATGGAGGAGTTGCCAGAGAATGGTTCTTCCTGATCTCAAAGGAAATGTTTAACCCTTATTATGGGTTGTTTGAATATTCTGCTACGGACAATTATACCCTACAGATAAATCCAAACTCTGGATTGTGTAACGAAGATCACCTCTCTTACTTCAAGTTTATTGGTCGGGTAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wu Wen et al.
Cell cycle (Georgetown, Tex.), 16(16), 1509-1514 (2017-07-27)
The neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) plays a pivotal oncogenic role in various types of human cancers. However, the function of NEDD4 in bladder cancer has not been fully investigated. In the present study, we aim to
Shaoyan Feng et al.
Cell cycle (Georgetown, Tex.), 16(9), 869-878 (2017-04-06)
Nasopharyngeal carcinoma (NPC) is a highly invasive head-neck cancer derived from the nasopharyngeal epithelium, mainly prevalent in southern China and Southeast Asia. Radiotherapy and adjuvant cisplatin (DDP) chemotherapy are standard administrations applied in the treatment of NPC. However, resistance to
Seon-Ae Jeon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 14772-14783 (2019-11-07)
E3 ubiquitin ligases are involved in the regulation of oxidative stress-induced cell death. In this study, we investigated the role of neural precursor cell-expressed, developmentally down-regulated protein 4 (NEDD4) in regulation of hydrogen peroxide (H2O2)-induced cell proliferation and apoptosis in
Qiong Lin et al.
Journal of cell science, 130(22), 3839-3850 (2017-10-13)
Our previous studies have shown that the HECT E3 ubiquitin ligase NEDD4 interacts with LC3 and is required for starvation and rapamycin-induced activation of autophagy. Here, we report that NEDD4 directly binds to SQSTM1 via its HECT domain and polyubiquitylates
Jin Zhang et al.
American journal of translational research, 11(6), 3461-3471 (2019-07-18)
Prostate cancer is the second most common malignancy among men and causes a myriad of health problem for males that are diagnosed with the cancer. Although the 5-year relative survival rate of prostate cancer patients has been significantly increased due

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service