Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTCAGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGGGGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SIRT6(51548)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ganye Zhao et al.
Aging, 8(10), 2308-2323 (2016-10-31)
Sirtuin6(SIRT6) has been implicated as a key factor in aging and aging-related diseases. However, the role of SIRT6 in cellular senescence has not been fully understood. Here, we show that SIRT6 repressed the expression of p27Kip1 (p27) in cellular senescence.
Ming-Yue Cheng et al.
American journal of translational research, 8(11), 5005-5015 (2016-12-03)
The present study explored changes of the SIRT6/NF-κB pathway in myocardial hypoxia/reoxygenation induced injury and the effects on mitochondrial damage and myocardial damage by regulating SIRT6. SIRT6 expression decreased and NF-κB expression increased in H9c2 cells during hypoxic injury. Cell
Ning Qu et al.
International journal of oncology, 50(5), 1683-1692 (2017-04-11)
Sirtuin 6 (SIRT6) is a member of the SIRT family NAD+‑dependent deacetylases reported to function in controlling organism homeostasis, lifespan, and diseases. This study investigated the role of SIRT6 in papillary thyroid cancer (PTC). Data of 391 PTC patients was extracted
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU132901-20UG | 04061828684533 |
| EHU132901-50UG | 04061828459568 |