Skip to Content
Merck
CN

EHU133471

MISSION® esiRNA

targeting human MAPK7

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGTGACCCAGCAGCTATCTAAGTCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK7(5598)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Abrar Ul Haq Khan et al.
Scientific reports, 8(1), 7420-7420 (2018-05-11)
Oxidative phosphorylation (OXPHOS) generates ROS as a byproduct of mitochondrial complex I activity. ROS-detoxifying enzymes are made available through the activation of their antioxidant response elements (ARE) in their gene promoters. NRF2 binds to AREs and induces this anti-oxidant response.
Abrar Ul Haq Khan et al.
Scientific reports, 7(1), 10654-10654 (2017-09-08)
Controlling cholesterol levels is a major challenge in human health, since hypercholesterolemia can lead to serious cardiovascular disease. Drugs that target carbohydrate metabolism can also modify lipid metabolism and hence cholesterol plasma levels. In this sense, dichloroacetate (DCA), a pyruvate
Yan Huang et al.
Tumori, 103(5), 483-488 (2016-10-30)
Osteosarcoma (OS) is the most common primary bone tumor and has low cure rates. Our study aimed to evaluate the roles of mitogen-activated protein kinase 7 (MAPK7) in cell proliferation, migration and invasion using the SOSP-M human OS cell line
Byambasuren Vanchin et al.
The Journal of pathology, 247(4), 456-470 (2018-12-20)
Endothelial-mesenchymal transition occurs during intimal hyperplasia and neointima formation via mechanisms that are incompletely understood. Endothelial MAPK7 signaling is a key mechanosensitive factor that protects against endothelial-mesenchymal transition, but its signaling activity is lost in vessel areas that are undergoing
Dae-Hwan Nam et al.
Molecules and cells, 40(7), 457-465 (2017-07-07)
Streptozotocin (STZ)-induced murine models of type 1 diabetes have been used to examine ER stress during pancreatic β-cell apoptosis, as this ER stress plays important roles in the pathogenesis and development of the disease. However, the mechanisms linking type 1

Global Trade Item Number

SKUGTIN
EHU133471-50UG04061828460137
EHU133471-20UG04061831364279

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service