Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGATCCTGATCCTGCCATCCGACGTCCAGCTGAGAAATTTCTTGAATCTGTTGAAGGAAATCAGAATTATCCACTGTTGCTTTTGACATTACTGGAGAAGTCCCAGGATAATGTTATCAAAGTATGTGCTTCAGTAACATTCAAAAACTATATTAAAAGGAACTGGAGAATTGTTGAAGATGAACCAAACAAAATTTGTGAAGCCGATCGAGTGGCCATTAAAGCCAACATAGTGCACTTGATGCTTAGCAGCCCAGAGCAAATTCAGAAGCAGTTAAGTGATGCAATTAGCATTATTGGCAGAGAAGATTTTCCACAGAAATGGCCTGACTTGCTGACAGAAATGGTGAATCGCTTTCAGAGTGGAGATTTCCATGTTATTAATGGAGTCCTCCGTACAGCACATTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CSE1L(1434)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Woan-Ruoh Lee et al.
Molecular carcinogenesis, 55(11), 1542-1552 (2015-09-04)
The Ras/ERK (extracellular signal-regulated protein kinase) and cAMP/PKA (protein kinase A) pathways are essential for the transcriptional activities of CREB (cAMP response element binding protein) and MITF (microphthalmia-associated transcription factor) in melanogenesis and the progression of melanoma. However, the interaction
Xuebing Wang et al.
OncoTargets and therapy, 13, 1941-1951 (2020-04-11)
Recent studies have shown that noncoding RNAs (ncRNAs) play essential roles in the development of a number of cancers. Circular RNAs (circRNAs) have been shown to contribute to the progression of colorectal cancer (CRC). In this study, the expression levels
Jose M Pimiento et al.
The American journal of pathology, 186(10), 2761-2768 (2016-08-16)
Human cellular apoptosis susceptibility (chromosomal segregation 1-like, CSE1L) gene plays a role in nuclear-to-cytoplasm transport and chromosome segregation during mitosis, cellular proliferation, and apoptosis. CSE1L is involved in colon carcinogenesis. CSE1L gene expression was assessed with three data sets using
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU133691-20UG | 04061831364323 |
| EHU133691-50UG | 04061828460304 |