Skip to Content
Merck
CN

EHU134181

MISSION® esiRNA

targeting human SATB1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAACAGGTTTCGACCAACACAGAGGTGTCTTCCGAAATCTACCAGTGGGTACGCGATGAACTGAAACGAGCAGGAATCTCCCAGGCGGTATTTGCACGTGTGGCTTTTAACAGAACTCAGGGCTTGCTTTCAGAAATCCTCCGAAAGGAAGAGGACCCCAAGACTGCATCCCAGTCTTTGCTGGTAAACCTTCGGGCTATGCAGAATTTCTTGCAGTTACCGGAAGCTGAAAGAGACCGAATATACCAGGACGAAAGGGAAAGGAGCTTGAATGCTGCCTCGGCCATGGGTCCTGCCCCCCTCATCAGCACACCACCCAGCCGTCCTCCCCAGGTGAAAACAGCTACTATTGCCACTGAAAGGAATGGGAAACCAGAGAACAATACCATGAACATTAATGCTTCCATTTATGATGAGATTCAGCAGGAAATGAAGCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mei-Ying Ning et al.
Journal of biochemistry, 168(1), 41-51 (2020-06-12)
This study aims to examine whether miR-448 reverses the cisplatin (DDP) resistance in lung cancer by modulating SATB1. QRT-PCR and immunohistochemistry were used to examine the miR-448 and SATB1 expressions in DDP-sensitive and -resistant lung cancer patients. A microarray was
Lei Guo et al.
Molecular medicine reports, 16(6), 8842-8848 (2017-10-11)
Special AT‑rich sequence‑binding protein 1 (SATB1) is a master chromatin organizer which has been reported to be implicated in tumor progression in breast and lung cancer. However, its functions in pancreatic tumorigenesis have yet to be elucidated. In the present
Haiying Rao et al.
The journal of maternal-fetal & neonatal medicine : the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstetricians, 32(12), 2069-2078 (2018-01-09)
Special AT-rich sequence binding protein 1 (SATB1) play potential roles in invasion and metastasis of tumor cells, and involves in human placental and fetal development. The objective of this study is to explore the role of SATB1 in migration and
Markus Riessland et al.
Cell stem cell, 25(4), 514-530 (2019-09-24)
Cellular senescence is a mechanism used by mitotic cells to prevent uncontrolled cell division. As senescent cells persist in tissues, they cause local inflammation and are harmful to surrounding cells, contributing to aging. Generally, neurodegenerative diseases, such as Parkinson's, are
Fu-Chun Huo et al.
Cell death and differentiation, 26(6), 994-1006 (2018-08-08)
p21-activated kinase 5 (PAK5) is involved in several oncogenic signaling pathways and its amplification or overexpression has been found in various types of cancer; however, the pathophysiologic role of PAK5 in cervical cancer (CC) remains elusive. This study aims to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service