Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGACTTGGCCGAGGAGCGGGGCCACCGCGACGTTGCAGGGTACCTGCGCACAGCCACGGGGGACTGACGCCAGGTTCCCCAGCCGCCCACAACGACTTTATTTTCTTACCCAATTTCCCACCCCCACCCACCTAATTCGATGAAGGCTGCCAACGGGGAGCGGCGGAAAGCCTGTAAGCCTGCAAGCCTGTCTGAGACTCACAGGAAGGAGGAGCCGACCGGGAATAACCTTCCATACATTTTTTTCTTTGTCTTATCTGGCCCTCGACACTCACCATGAAGCGAAACACAGAGAAGCGGATTTCCAGGGATATTTAGGAGTGTGTGACATTCCAGGGGTCGTTTGCTTTTCAGGGTTTTCTGAGGGAAAGTGCATATGAAATCCTTGACTGGACCTGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDKN2B(1030)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiangeng Yang et al.
Oncotarget, 8(40), 68721-68729 (2017-10-06)
Hsa-miR-429 is increased in bladder cancer. Its roles in bladder cancer are poorly understood. The expression levels of hsa-miR-429 and cyclin-dependent kinase inhibitor 2B (CDKN2B) were determined using Real-Time qPCR in a total of 50 patients with bladder cancer. Bladder
Mu Xu et al.
Molecular cancer, 17(1), 141-141 (2018-09-30)
Mounting evidence demonstrates that long noncoding RNAs (lncRNAs) have critical roles during the initiation and progression of cancers. In this study, we report that the small nucleolar RNA host gene 1 (SNHG1) is involved in colorectal cancer progression. We analyzed
Steven K Huang et al.
PloS one, 9(9), e107055-e107055 (2014-09-13)
Excessive fibroproliferation is a central hallmark of idiopathic pulmonary fibrosis (IPF), a chronic, progressive disorder that results in impaired gas exchange and respiratory failure. Fibroblasts are the key effector cells in IPF, and aberrant expression of multiple genes contributes to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU134441-50UG | 04061828460984 |
| EHU134441-20UG | 04061831364484 |