Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PDE4B(5142)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Ming-Yu Chen et al.
Bioengineered, 12(1), 708-719 (2021-02-02)
Reportedly, long non-coding RNA (lncRNA) are crucial modulators in neurodegenerative diseases. Herein, we investigated the role of lncRNA nuclear enriched abundant transcript 1 (NEAT1) in Parkinson's disease (PD). In-vitro PD model was established based on SH-SY5Y cells treated with 1-methyl-4-phenylpyridinium
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU134591-20UG | 04061831364521 |
| EHU134591-50UG | 04061828420940 |