Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCGAGGAAAAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTCATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATATGATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATTGAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTTTGATTGTGCCTGGTTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SMARCA2(6595)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Tharu M Fernando et al.
Nature communications, 11(1), 5551-5551 (2020-11-05)
Genomic studies performed in cancer patients and tumor-derived cell lines have identified a high frequency of alterations in components of the mammalian switch/sucrose non-fermentable (mSWI/SNF or BAF) chromatin remodeling complex, including its core catalytic subunit, SMARCA4. Cells exhibiting loss of
Erika Zernickel et al.
Molecular cancer therapeutics, 18(3), 656-666 (2018-11-28)
Targeting of epigenetic regulators as the chromatin remodeler SWI/SNF is proving to be a promising therapeutic strategy for individualized treatment of cancer patients. Here, we tested whether targeting one of the two mutually exclusive subdomains of the SWI/SNF complex BRM/SMARCA2
Qiong Wu et al.
Journal of cellular physiology, 230(11), 2683-2694 (2015-03-27)
The Brahma (BRM) and Brahma-related Gene 1 (BRG1) ATPases are highly conserved homologs that catalyze the chromatin remodeling functions of the multi-subunit human SWI/SNF chromatin remodeling enzymes in a mutually exclusive manner. SWI/SNF enzyme subunits are mutated or missing in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU135151-20UG | 04061828646715 |
| EHU135151-50UG | 04061831375640 |