Skip to Content
Merck
CN

EHU135291

MISSION® esiRNA

targeting human LASP1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAAGCCCTACTGCAACGCACACTACCCCAAGCAGTCCTTCACCATGGTGGCGGACACCCCGGAAAACCTTCGCCTCAAGCAACAGAGTGAGCTCCAGAGTCAGGTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGACACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAACATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTAGCGGGGGCGAGGGCATGGAGCCAGAGCGTCGGGATTCACAGGACGGCAGCAGCTACCGGCGGCCCCTGGAGCAGCAGCAGCCTCACCACATCCCGACCAGTGCCCCGGTTTACCAGCAGCCCCAGCAGCAGCCGGTGGCCCAGTCCTATGGTGGCTACAAGGAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Li et al.
Oncology research, 25(8), 1269-1282 (2017-01-25)
MicroRNAs (miRs), a class of small noncoding RNAs, are key gene regulators through inducing translational repression or degradation of their target genes. However, the regulatory mechanism of miR-133b underlying hepatocellular carcinoma (HCC) growth and metastasis remains largely unclear. Here we
Shiping Hu et al.
Oncology reports, 38(3), 1569-1578 (2017-07-18)
Hepatocellular carcinoma (HCC) is the fifth-most common cancer and third leading cause of cancer-related deaths worldwide. Increasing evidence indicates that dysregulation of microRNAs is often observed in HCC, and has been extensively investigated in terms of cancer formation, progression, diagnosis
Wei Gao et al.
Oncology research, 25(6), 879-886 (2016-12-13)
LIM and SH3 protein 1 (LASP-1) is a specific focal adhesion protein that was first identified in breast cancer and then reported to be involved in cell proliferation and migration. Many studies have demonstrated the essential role of LASP-1 in
Hui Li et al.
Oncotarget, 8(56), 95880-95895 (2017-12-10)
MicroRNAs (miRs) have been demonstrated to play promoting or tumor suppressive roles in various human cancers, but the regulatory mechanism of miR-29b underlying gastric cancer development and progression still remains largely unclear. In the present study, we found that miR-29b
Min Fang et al.
The international journal of biochemistry & cell biology, 87, 95-103 (2017-04-17)
Preeclampsia (PE) is a major contributor to maternal morbidity and mortality. However, the molecular mechanisms underlying PE progression are not well characterized. Here, we investigated the role of miR-218 in PE development. The expression of miR-218 and its host genes

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service