Skip to Content
Merck
CN

EHU136691

MISSION® esiRNA

targeting human SRPX2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCACTGTGATGGCGGTTATGATCGCCAGGGGACACCCTCCCGGGTCTGTCAGTCCAGCCGCCAGTGGTCAGGTTCACCACCAATCTGTGCTCCTATGAAGATTAACGTCAACGTCAACTCAGCTGCTGGTCTCTTGGATCAATTCTATGAGAAACAGCGACTCCTCATCATCTCAGCTCCTGATCCTTCCAACCGATATTATAAAATGCAGATCTCTATGCTACAGCAATCCACCTGTGGACTGGATTTGCGGCATGTGACCATCATTGAACTGGTGGGACAGCCACCTCAGGAGGTGGGGCGCATCCGGGAGCAACAGCTGTCAGCCAACATCATCGAGGAGCTCAGGCAATTTCAGCGCCTCACTCGCTCCTACTTCAACATGGTGTTGATTGACAAGCAGGGTATTGACCGAGACCGCTACATGGAACCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiujuan Li et al.
Acta biochimica Polonica, 67(2), 165-172 (2020-06-19)
Recent studies showed that sushi repeat containing protein X linked 2 (SRPX2) could participate in the development of various malignant tumors. However, its role in non-small cell lung cancer (NSCLC) was unknown. The aim of the study was to prospectively
Xin Hong et al.
Journal of biochemical and molecular toxicology, e22237-e22237 (2018-12-12)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is reported to play a critical role in tumorigenesis. However, the expression and functional role of SRPX2 in prostate cancer have not been defined. Thus, the aim of this
Xiaobo Lin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 93, 398-405 (2017-06-28)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is overexpressed in human cancer. Recent studies have reported that SRPX2 overexpression is observed in gastrointestinal cancer, and promotes migration and invasion of cancer cells. While, the clinical significance

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service