Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACCACTGTGATGGCGGTTATGATCGCCAGGGGACACCCTCCCGGGTCTGTCAGTCCAGCCGCCAGTGGTCAGGTTCACCACCAATCTGTGCTCCTATGAAGATTAACGTCAACGTCAACTCAGCTGCTGGTCTCTTGGATCAATTCTATGAGAAACAGCGACTCCTCATCATCTCAGCTCCTGATCCTTCCAACCGATATTATAAAATGCAGATCTCTATGCTACAGCAATCCACCTGTGGACTGGATTTGCGGCATGTGACCATCATTGAACTGGTGGGACAGCCACCTCAGGAGGTGGGGCGCATCCGGGAGCAACAGCTGTCAGCCAACATCATCGAGGAGCTCAGGCAATTTCAGCGCCTCACTCGCTCCTACTTCAACATGGTGTTGATTGACAAGCAGGGTATTGACCGAGACCGCTACATGGAACCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SRPX2(27286)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xin Hong et al.
Journal of biochemical and molecular toxicology, e22237-e22237 (2018-12-12)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is reported to play a critical role in tumorigenesis. However, the expression and functional role of SRPX2 in prostate cancer have not been defined. Thus, the aim of this
Xiujuan Li et al.
Acta biochimica Polonica, 67(2), 165-172 (2020-06-19)
Recent studies showed that sushi repeat containing protein X linked 2 (SRPX2) could participate in the development of various malignant tumors. However, its role in non-small cell lung cancer (NSCLC) was unknown. The aim of the study was to prospectively
Xiaobo Lin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 93, 398-405 (2017-06-28)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is overexpressed in human cancer. Recent studies have reported that SRPX2 overexpression is observed in gastrointestinal cancer, and promotes migration and invasion of cancer cells. While, the clinical significance
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU136691-50UG | 04061828422609 |
| EHU136691-20UG | 04061828647941 |