Skip to Content
Merck
CN

EHU136991

MISSION® esiRNA

targeting human KDM4B

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human KDM4B

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCAGGAACCATCACTGTTGCTGGAGGCACCTGACAAATCCTAGCGAATTTTTGGAGCATCTCCACCCAGGAACCTCGCCATCCAGAAGTGTGCTTCCCGCACAGCTGCAGCCATGGGGTCTGAGGACCACGGCGCCCAGAACCCCAGCTGTAAAATCATGACGTTTCGCCCAACCATGGAAGAATTTAAAGACTTCAACAAATACGTGGCCTACATAGAGTCGCAGGGAGCCCACCGGGCGGGCCTGGCCAAGATCATCCCCCCGAAGGAGTGGAAGCCGCGGCAGACGTATGATGACATCGACGACGTGGTGATCCCGGCGCCCATCCAGCAGGTGGTGACGGGCCAGTCGGGCCTCTTCACGCAGTACAATATCCAGAAGAAGGCCATGACAGTGGGCGAGTACCGCCGCCTGGCCAACAGCGAGAAGTACTGTACCCCGCGGCACCAGGACTTTGATGACCTTGAACGCAAATACTGGAAGAACCTCACCTTTGTCTCCCCGATCTACGGGGCTGACATCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dong-E Tang et al.
The Journal of pathology, 252(2), 101-113 (2020-07-04)
The histone demethylase KDM4B functions as a key co-activator for the androgen receptor (AR) and plays a vital in multiple cancers through controlling gene expression by epigenetic regulation of H3K9 methylation marks. Constitutively active androgen receptor confers anti-androgen resistance in
Ji-Hyun Kim et al.
International journal of molecular sciences, 21(21) (2020-11-11)
Ligand-activated liver X receptor α (LXRα) upregulates the expression of hepatic lipogenic genes, which leads to triglyceride (TG) accumulation, resulting in nonalcoholic fatty liver disease (NAFLD). Thus, LXRα regulation may provide a novel therapeutic target against NAFLD. However, histone methylation-mediated
Amitabh Das et al.
Experimental cell research, 328(2), 361-378 (2014-09-07)
JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of
Shuo Li et al.
Acta biochimica et biophysica Sinica, 47(12), 997-1004 (2015-10-30)
Lysine (K)-specific demethylase 4B (KDM4B) is a histone H3K9 demethylase and is reported to activate gene transcription through regulation of chromatin structures. Previous research has revealed that KDM4B plays special regulatory roles in colorectal, prostate and gastric cancers. However, its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service