Skip to Content
Merck
CN

EHU137791

MISSION® esiRNA

targeting human KIF14

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGGGAACCCGACATTACAGATGCACCAGTTTCTTCACTTTCTAGAAGGAGGAGTAGGAGTTTGATGAAGAACAGAAGAATTTCTGGTTGTTTACATGACATACAAGTCCATCCAATTAAGAATTTGCATTCTTCACATTCATCAGGTTTAATGGACAAATCAAGCACTATTTACTCAAATTCAGCAGAGTCCTTTCTTCCTGGAATTTGCAAAGAATTGATTGGTTCTTCGTTAGATTTTTTTGGACAGAGTTATGATGAAGAAAGAACTATAGCAGACAGCCTAATTAATAGTTTTCTTAAAATTTATAATGGGCTATTTGCCATTTCCAAGGCTCATGAAGAACAAGATGAAGAAAGTCAAGATAACTTGTTTTCTTCTGATCGAGCAATCCAGTCACTTACTATTCAGACTGCATGTGCTTTTGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Petra Pejskova et al.
The Journal of cell biology, 219(6) (2020-04-30)
Primary cilia play critical roles in development and disease. Their assembly and disassembly are tightly coupled to cell cycle progression. Here, we present data identifying KIF14 as a regulator of cilia formation and Hedgehog (HH) signaling. We show that RNAi
Kay Ka-Wai Li et al.
Laboratory investigation; a journal of technical methods and pathology, 97(8), 946-961 (2017-05-16)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. At present, there is no well-established targeted drug for majority of patients. The kinesin family member 14 (KIF14) is a novel oncogene located on chromosome 1q and is dysregulated
Wei Huang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1659-1670 (2015-11-05)
The mitotic kinesin superfamily protein KIF14 is essential for cytokinesis and chromosome segregation, and increased KIF14 expression is related to a variety of human cancers. However, the role of KIF14 in the development and malignant progression of astrocytomas and the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service