Skip to Content
Merck
CN

EHU137841

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPE

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCTTGAGTTGGCTCAGAAACTTAATGAAAATTATGAGGAAGTGAAATCTATAACCAAAGAAAGAAAAGTTCTAAAGGAATTACAGAAGTCATTTGAAACAGAGAGAGACCACCTTAGAGGATATATAAGAGAAATTGAAGCTACAGGCCTACAAACCAAAGAAGAACTAAAAATTGCTCATATTCACCTAAAAGAACACCAAGAAACTATTGATGAACTAAGAAGAAGCGTATCTGAGAAGACAGCTCAAATAATAAATACTCAGGACTTAGAAAAATCCCATACCAAATTACAAGAAGAGATCCCAGTGCTTCATGAGGAACAAGAGTTACTGCCTAATGTGAAAGAAGTCAGTGAGACTCAGGAAACAATGAATGAACTGGAGTTATTAACAGAACAGTCCACAACCAAGGACTCAACAACACTGGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zijie Liu et al.
Journal of experimental & clinical cancer research : CR, 28, 156-156 (2009-12-22)
CENP-E, one of spindle checkpoint proteins, plays a crucial role in the function of spindle checkpoint. Once CENP-E expression was interrupted, the chromosomes can not separate procedurally, and may result in aneuploidy which is a hallmark of most solid cancers
Lina Shan et al.
International journal of oncology, 55(1), 257-266 (2019-05-23)
Lung cancer is the most common and most lethal type of cancer. A sustained proliferative capacity is one of the hallmarks of cancer, and microtubules serve an important role in maintaining a sustained cell cycle. Therefore, understanding the regulation of
Vitali Sikirzhytski et al.
The Journal of cell biology, 217(8), 2647-2659 (2018-06-17)
For proper segregation during cell division, each chromosome must connect to the poles of the spindle via microtubule bundles termed kinetochore fibers (K-fibers). K-fibers form by two distinct mechanisms: (1) capture of astral microtubules nucleated at the centrosome by the
Zhen-Yu She et al.
Cell death discovery, 6, 25-25 (2020-05-01)
Kinesin-7 CENP-E is an essential kinetochore motor required for chromosome alignment and congression. However, the specific functions of CENP-E in the spermatogenic cells during spermatogenesis remain unknown. In this study, we find that CENP-E proteins are expressed in the spermatogonia
Carmen Taveras et al.
Cell cycle (Georgetown, Tex.), 18(12), 1349-1363 (2019-05-28)
During mitosis, Aurora B kinase is required for forming proper bi-oriented kinetochore-microtubule attachments. Current models suggest that tension exerted between a pair of sister-kinetochores (inter-kinetochore stretch) produces a spatial separation of Aurora B kinase from kinetochore-associated microtubule binding substrates, such

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service