Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTACAGATGCCCACAACCTGCACTCCCTCACCTCCATCGTGGACAGCATCACAGTGGAAGATGTGTCTGTGGCCTTCCCAGATGAAACCATGCCCAACTGAGATTGTCTTCCAAGCCGGGCATCCTTGCGAGCCCCCCAAGCTGGCCACAGATGCCACTACTTCTGTAGCAGGGGCCTCCTAAGCCAGGCTGCCCTGATGCTAGGAAGCCAGCTCTGGGGTGCCATAGGCCAGACTATCCCCTTCCTCATCCATGTAAGGTTAACCCACCCCCCAGCAAGGGACTGGACGCCCTCATTCAGCTGCCTCCTTAGAGGAGAGGGCATCCCCTTTCCAGGGAGGTAAAGCAGGGGACCAGAGCGCCCCCTCGTGTATGCCCCAGCTCAGGGGGCAAACTCAGGAGCTTCCTTTTTATCATAACGCGGCCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MYOG(4656)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chi Yan et al.
International journal of molecular sciences, 16(10), 25014-25030 (2015-10-23)
Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of
Zhihui Liu et al.
Nature communications, 11(1), 911-911 (2020-02-16)
Embryonal rhabdomyosarcoma (ERMS) is a childhood cancer that expresses myogenic master regulatory factor MYOD but fails to differentiate. Here, we show that the zinc finger transcription factor CASZ1 up-regulates MYOD signature genes and induces skeletal muscle differentiation in normal myoblasts
Adeel Malik et al.
PloS one, 10(7), e0133597-e0133597 (2015-07-23)
Muscle, a multinucleate syncytium formed by the fusion of mononuclear myoblasts, arises from quiescent progenitors (satellite cells) via activation of muscle-specific transcription factors (MyoD, Myf5, myogenin: MYOG, and MRF4). Subsequent to a decline in Pax7, induction in the expression of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU138681-50UG | 04061828411917 |
| EHU138681-20UG | 04061831364927 |